lunes, 2 de julio de 2012

9 meses, 9 causas: Julio

(by *Lady Cup Cake in Paris*)
Buenos días de lunes ligeramente  fresco, por decir algo, comenzamos mes y con él nueva causa:
No más intentos de estafa mediante la venta de cutre-prendas en blogs-mercadillos, no más cutre tiendas de blogleras con cosas chungas y roñosas que vender
¿Será posible que esta nueva causa salga adelante?
¿y más cuando precisamente ayer comenzaron las rebajas?
¿Harán también rebajas nuestra queridísimas en sus “cutre tiendas”?
Y como nota interesante ¿habrá rinconcito ordenado en las “cutre tiendas” de nuestras queridísimas?
¿Seguirán intentando endosarnos a precio de tienda sus cosas chungas y roñosas?
¿Admitirán devoluciones?
¿Podremos adquirir cositas y luego devolverlas tras hacernos unas fotitos veraniegas cerca del mar (o de la montaña)?
Cuántas preguntas para empezar la semana, tenemos un mes para encontrarles respuesta, de momento reflexionemos sobre ello como si no hubiera un mañana.

¡¡Y FELICIDADES A LA SELECCIÓN ESPAÑOLA!!
¡¡QUÉ GRANDES SOMOS!!

                                                                                Becaria, Ainharita, Miss ¡¡OS QUEREMOS!!
                                                                             Marcela, ¿where are you?

78 comentarios:

  1. La traficante es buen ejemplo de vendedora EB.

    Hoy le hace publi (aparte de a sí misma como siempre) a una "colega" y como los favores se pagan caros, jojojo, nos la presenta con esta foto, ¡¡si soy la otra me dá un parraque!!

    https://lh3.googleusercontent.com/-JEg7AUxLIMY/T_C-eiUI3nI/AAAAAAAAFPo/MViSzUjx24E/s640/blogger-image-357826444.jpg

    ResponderEliminar
  2. Oñó como me suena la del ceño fruncido!!!! La porno-devuelveropa buscó una foto en la que ella saliera divina de la muerte y su compi no, aún así que no se moleste, se ve a legua que su compi es más guapa!!!!!!!

    ResponderEliminar
    Respuestas
    1. Ains esto iba a responder..... estoy Anatxuizada....


      Buenos días Bizcochín!!! qué gran post llenos de incógnitas!!!!!

      Esta causa es más complicada, hay cutreces everywhere, tenemos que hacer un trabajo de investigación!!!

      Por lo pronto voy a cambiar el mes en el lateral...

      Eliminar
    2. ¡¡Buenos días Marcelita!! ¡¡cuántos días sin coincidir contigorl!!

      Eliminar
    3. Here I am!!!!! No había visto mi mención!!!!!

      Bizcochín mío, qué te voy a contar que no te haya contado ya........ Menos mal que estás tú!!!!!

      Y felicidades por lo de ayer, ruaro ruaro que no hayas cantado nada en un comment......

      Eliminar
    4. uyyyy canté todos los goles en tuiter, y fueron muchos!!!!!!!!!!

      Eliminar
    5. Esto es un homenajepeich a la roja y lo demás cuentos:

      http://s1189.photobucket.com/albums/z422/GUCCISIMA/GUCCISIMA%20BLOG/?action=view&current=IMG_4792.jpg

      http://s1189.photobucket.com/albums/z422/GUCCISIMA/GUCCISIMA%20BLOG/?action=view&current=IMG_4713.jpg

      Eliminar
    6. Oyoyoyoyoyoyoyyyyyyyy ¿De qué se ha disfrazado?????
      Yo no sé dónde está el chic del hippie-chic........

      https://lh3.googleusercontent.com/-vdpzDkHkMTI/T_C9iilwZvI/AAAAAAAAFOs/AHD7HvnZlpI/s640/blogger-image--1556514959.jpg

      Eliminar
    7. ...o el caballo.

      Anónima en las sombras

      Eliminar
  3. Buenos díassssssssssss sus deseo a todas! y yo dejando comment en el post anterior...

    Anónima en las sombras

    ResponderEliminar
  4. UUUUUuuuuuHHHHhhhhh!!!!! Leo sweet dress de título en el post de niclis y ya me echo a temblar sabiendo que hay pepona´s luc.....

    ResponderEliminar
    Respuestas
    1. Jajajaja siiiii!!! Pepona pero felíiiiz, ni una pic oliendo peo...

      Anónima en las sombras

      Eliminar
    2. el bolso me parece feísimo (los zapatos en su linea, ya ni comento), el vestido es un poco raro con ese escote pero en ella me gusta, sí, me gusta, y me encanta su cara de 'no oler pedo' en todas las fotos, así sí!!!

      Eliminar
    3. Pues a mí su cara de oler pedos me encanta.... sonriendo la veo otra más que pone caritas para la foto....

      Neclis vuelve a oler pedos plis!!!!!!

      Y su ouchfit nein NEIN!!!!!

      Eliminar
    4. Podía repasar el post ante de publicar: "El rosa pastel es el protagonista de este outfit, tanto en el vestido muy como en el..."
      ¿muy? ¿Mande?
      Por favor, que los de cuadenillos Rubio o los de vacaciones Santilla hagan una campaña con las EB
      Saludos a las Marlelas madrugadoras

      Eliminar
    5. Como puede ser ese su bolso favoritor!! Si es todo un DIY con los tapetes de la abuela que le sobraban!

      Eliminar
    6. quien es neclis? que me lio jaja

      Eliminar
    7. Neclace of pearls, rebautizada por su exquisito inglés...

      Eliminar
  5. Y bravorl por abu que hoy no se tapa el pompis con el bolso!!!!!

    ¡¡¡¡¡Bravorl!!!!!!!!!!

    (obviaré que en la última foto se tape con las manos....)

    ResponderEliminar
    Respuestas
    1. jajajajajaj es verdad, hoy semienseña posaderas!! la foto con las manitas atrás es de traca, tan ñoña como ella!

      Eliminar
    2. Esta mujer... de verdad abu! còmo se puede ser tan sosa!?
      Catia

      Eliminar
    3. discreta anónimo, discreta. Sosa es otra cosa

      Eliminar
  6. Y Anatxu se lleva el premio del año al Satchel más feo... fluorescente y de leopardo. Ante eso, sólo puedo decir: Mis ojosssssssss, mis ojoooooooooooooos

    ResponderEliminar
    Respuestas
    1. Ay!!Anatxu Anatxu!!! esos primeros planos con brillores incluidos on the face..!!
      Y la tienda???? cómo se ve a leguas que son artículos made in chinese (el olor a plasticorro traspasa la pantalla)puestos en lo que se pretende presentar como una "butiquerr"..... todo un acierto haber elegido a anatxu como embajadora.

      Eliminar
    2. Paula Echevarría también lo mostró en amarillo fluor con estampado. Deberían de reconocer que en verdad les parece horrendo pero se lo ponen para ir muy "IN"... Pobrecitas

      Eliminar
    3. Anatxu rebautiza el satchel aunténtico en su blog. Ahora la marca se llama "satchel compañy" con eñe, ¡sí señora!

      Eliminar
  7. Hola, llevo ya unos mesecillos pasandome por aqui para reirme con vuestras ocurrencias, me lo paso pipa, pero nunca he comentado antes, no suelo tener mucho tiempo ni nada especial que contar,pero mira, hoy he visto esto y nada empiezo a colaborar un poco con la causa del despelleje,os paso estas dos bloggers clones (cual Espartaxu y la otra, que iban igualicas XD) : adicta y malena : http://i41.tinypic.com/33x95ap.jpg y http://stylelovely.com/sites/all/files/user/b-rock2.jpg (espero haber hecho bien el corta y pega de direcciones de las imagenes :))Porque esta copia tan descarada??

    ResponderEliminar
    Respuestas
    1. Jajajajaja, es muy muy original, ha cambiado el bolso!

      Eliminar
    2. Y quien publicó primero? Lady es estilosa, malena es guapisima pero estropea muchas prendas. En esta se salva, la verdad...

      Eliminar
    3. Mi no entender por qué llevan ese tipo de camisetas, si seguro que no han escuchado a ese gran grupo en toda su vida... Ahí lo dejo!

      Eliminar
  8. Hola a tod@s. Soy nueva en el blog y no quiero "chupar post", pero quería llamar la atención sobre la cantidad de animaladas y palurdadas que ponen las bloggers que escriben en inglés. Como muestra, un botón. La Marysky escribe en su post de ayer que iba a ver el partido de fútbol en Italia, y dice (sic) "I´m a little bit excited and also scary hahaha". Ha ha ha indeed! Porque lo que ha dicho es "estoy un poco nerviosa y también asusto/doy miedo". WTF???? Veremos si lo cambia, señal de que lee vuestro blog. Atentos!!!
    Besos y gracias por dejarme participar.

    ResponderEliminar
    Respuestas
    1. Si, lo suyo hubiera sido que pusiese "scared" pero bueno ya sabemos, su "inglis" hay que cogerlo con pinzas....

      Anónima en las sombras

      Eliminar
    2. No hay ni una que se salve. Para mí todas escriben como el culo, pero no solo en inglés, también en español.
      Lo mejor es que marisky pone el inglés antes que el español... no se puede ser más triste.

      Eliminar
    3. A mi triste me parece Barratac que no solo escribe mal elinglés sino que el francés da mucha pena.
      Hay que aconsejarle a esta chica que se limite a escribir en español, aunque buena ella es bastante limitadita ya.

      Eliminar
    4. Menos mal que tenemos blogs como el vuestro donde además de aprender a escrbir, recibimos clases gratuitas de como insultar a las personas de forma elegante!!

      Eliminar
    5. Mary of the Skies, bebe un poco de agua y cálmate, chata, que se te ve el plumero cosa mala

      Eliminar
  9. ¿Qué dice Abu de un collar "que tan agotado estaba"?
    ¡¡¡¡Será que "estaba agotado"!!!! ¿no? Sin el "tan", que las cosas no están ni muy agotadas ni poco agotadas ni tan agotadas, están agotadas o no lo están, y se acabo!!!

    ResponderEliminar
    Respuestas
    1. ¿Y "me encanta el turquesa en todas sus versiones"? ¿What? ¿Turquesa? ¿Versiones?
      Como mucho el azul o el verde, pero el turquesa es turquesa, al menos para los que tenemos claro cuál es el color turquesa claro.....

      Eliminar
    2. Hola Lady! Pobre Abu van a cambiar el pantone para ella, para su turquesa y todas sus versiones! jaaaaaaaaaajajajajaa

      Eliminar
  10. sois muy aburridas y muy cansinas, vosotras mismas os cansais de leeros.
    Esto parece un partido España-Italia = Egobloggers-ladillas de Egobloggers (vosotras) y van ganando y siempre ganaran.
    A llorar al banquillo. 4-0

    ResponderEliminar
    Respuestas
    1. Uuuuuhhhhhh súper metáfora furbolística!!!!!!!!

      Eliminar
    2. Seeeeeeeeeee seeeeeeeeeee lo que tu digas GGGGGGGGUUUUUUUUAAAAAAAPAAAAAAA
      y Voldemort es la Vicente del Bosque de las EB que va rastreando cada jugada!!!

      Vamosssssssssssss no hay 2 sin 3!!!!!!!

      Eliminar
    3. Hola Marcelaaaaaaaaaa!!!!!

      Sube la mano y grita What the fuck!!

      Eliminar
    4. Ay, que alguien ha tenido ladillas hace poco...
      Pobre.

      Eliminar
  11. Kuka da un poco de miedito hoy con esos labios

    http://4.bp.blogspot.com/-DyoyYhEhdCQ/T_GhOQzUFQI/AAAAAAAADx8/DiGh-FdW5kw/s1600/IMG_4703.jpg

    ResponderEliminar
    Respuestas
    1. Y ese pelo frito ??

      Mi no entender

      Eliminar
  12. Bueeeeeenas tardes marlelas guapas!!!!!
    Cansadita vengo de las rebajas. Tendría que estar catalogado como deporte de riesgo!!!
    Hago rondita y me encuentro el horrooooooooroso satchel de leoparda de Anatxu. Feo feo feo!!!
    Y no sé donde estaría suuuuper agotado el collar de Abu porque lo ví hoy por la tarde en Blanco. En fins...

    ResponderEliminar
  13. Aaay madre, que ha este paso la latin bolenas abren un centro de estética!!! Al tiempo....

    ResponderEliminar
    Respuestas
    1. Otras que podían repasar los post antes de publicar:
      "el que tiene el pelo rizo, lo quiere liso" ¿pelo rizo?
      Y la mejor :" Así que cojí mis tenacillas" ¿Cojí?

      Eliminar
    2. Otra: "Ala majos"... Ala sin h es lo que tienen las aves,
      latinbolenas... Una regla simple: Alas de pollo de telepizza... así seguro que no hay más errores.

      Eliminar
  14. Se ve que ya empezaron las rebajas, el sabado salí de compras a ver que había, me toco ver a los novios, esposos, queridos, lo que sea, esperando junto al probador, algunos ponen cara de sufridos. A mí no me gusta, no se porque pero yo prefiero ir sola.

    ResponderEliminar
  15. zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz...........zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz.................zzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzzz aburrimiento Marlelo este blog esta en plena decadencia.
    Apaga y vamonos.

    ResponderEliminar
  16. No sé a quién me recuerdan estas poses tontas.... estoy fatal de memoria...

    http://paula-echevarria.blogs.elle.es/files/2012/07/image1.jpg

    http://paula-echevarria.blogs.elle.es/files/2012/07/image_131.jpg

    ResponderEliminar
    Respuestas
    1. Jojojojojojoj PACA, es clavadita!!!!!!!

      Que te falle la memoria es señal de que la terapia va bien.

      Eliminar
    2. a ver, si es que se caen super bien, ya lo dijo marisky una vez... seguramente vayan el sabado a cenar con los churris jaja
      esta pauli está cada vez peor, ya tenia su blog mas que olvidado de la lista pero como siga a si hasta lo borro...
      maria

      Eliminar
  17. Hola chicas!!! Después de un tiempo desaparecida, ¡¡he vuelto!! Eso sí, aunque no haya tenido tiempo para comentar, no he dejado de leeros..
    Me encanta tu post de hoy Lady Cup!!! Y para contribuir un poquito, os dejo el enlace de Mis-viajecitos-super-parisinos que nos deleite precisamente en el post de hoy, ¡¡con un mercadillo!! Parece que nos hubiera leído...

    http://shopmesvoyagesaparis.blogspot.com.es/

    Me encanta eso del abrigo aún con la etiqueta puesta que dice que "no ha estrenado" pero con el que se ha hecho un chuting. ¿Será que no quita las etiquetas de la ropa que se pone para los chutings? ¿pero no era que la ropa que nos enseñaban en sus ouchfits era la que usaban en su día a día? Mi no entenderrrr... y no va y lo justifica diciendo que como se va al Caribe ya no lo necesita... ¿¿será por que ya lo intuía que no llegó a quitarle la etiquetita a pesar de usar el abriguito??? Misterios sin resolver...

    ResponderEliminar
    Respuestas
    1. Sorry *¿¿será porque ya ...

      Eliminar
    2. Hola Sam, buena aportación, mi tampoco entender...si sacas ropa en el blog se supone que es tu ropa del "día a día", como les gusta decir, asi que lo de vender "tu ropa" usada con etiqueta es el colmo ¿será que no se lo admitieron de vuelta en la tienda? ¿será que habitualmente sale a la calle con las etiquetas incorporadas? ¿qué será, será?

      Eliminar
  18. Que lleven las mismas copia-sandalias, vale. Pero que ambas fotos sean por los aires, no.

    Barratac: http://s695.photobucket.com/albums/vv319/bartabacmode/bartabacnotes/sandals/?action=view&current=24.jpg

    Dulcenech:
    http://imageshack.us/photo/my-images/600/51327803.png/

    B.

    ResponderEliminar
  19. Qué aburridas sois, de verdad chicas, a ver si os recicláis un poco porque este blog cada vez está peor.

    ResponderEliminar
    Respuestas
    1. aquí se comenta lo que se ve, es decir, que la blogosfera egoblogger mega fashion debe ser que está aburrida... nada nuevo no?
      no hace falta que leas el blog, pero puede venir bien que dejes una visita...tú sigue
      maria

      Eliminar
  20. Buenos días para todo el mundo, aquí seguimos dando los últimos coletazos de un blog moribundo.....ains...

    Abu, cada día cuidas menos los detalles, hoy nos enseñas tu ropa interior en varias fotos, así no!

    aquí: http://s1127.photobucket.com/albums/l624/ATRENDYLIFESTYLE/?action=view&current=PRINT_PANTS-SATCHEL_BAG-PASTEL-TURQUESA3-1.jpg

    aquí: http://s1127.photobucket.com/albums/l624/ATRENDYLIFESTYLE/?action=view&current=PRINT_PANTS-SATCHEL_BAG-PASTEL-TURQUESA1-1.jpg

    aquí: http://s1127.photobucket.com/albums/l624/ATRENDYLIFESTYLE/?action=view&current=PRINT_PANTS-SATCHEL_BAG-PASTEL-TURQUESA4-1.jpg

    y aquí: http://s1127.photobucket.com/albums/l624/ATRENDYLIFESTYLE/?action=view&current=COLLAGE2-1.jpg

    ResponderEliminar
    Respuestas
    1. Buenos días PAQUITA! Aqui, agonizando...

      Eliminar
    2. Si verdad?? A que hora venía el cura a darnos la extrema unción???

      Eliminar
    3. Pero y qué le ocurre en las uñas que las tiene todas podridas????

      Eliminar
  21. Bueeeeeenos días!!!
    Hoy Abu ha tirado la casa por la ventana y ha dicho... ale, a lo loco!!! Un día es un día y hoy voy a arriesgar!!! Y se ha plantado unos pantalones estampados de florecitas!!! Abuuuuu que de esta te encierran por arriesgada!!! Eso sí, las cuñas me parecen horrendas!!!

    ResponderEliminar
    Respuestas
    1. Y a Vascatxu un consejito de una no personal chopped... dices que las cuñas te estelizaran (o estelizarán aún no lo tengo claro).
      Querida, las cuñas con ese corte en el tobillo más que estilizar te acortar la pierna!! Yo que tú repasaba los apuntes del curso de CCC de personal chopped.

      Eliminar
    2. ¡Madre del amor hermoso! Anatxu me ha dejado sin palabras...

      Eliminar
  22. http://s612.photobucket.com/albums/tt204/Lovelypepamode/Blog1/?action=view&current=a60dcc61.jpg

    Mariescai, dale un buen bocado al helado que se te derrite!!!!!!!!!!!!!!!!!!!!!!!

    ResponderEliminar
  23. la de Cuestión de estilo (sí, esa que es personal choped dede hace más de 27 años, según ella misma) acudió a la inuguración del nuevo "stan" de no se qué marca, ¿y eso qué será?

    ResponderEliminar
    Respuestas
    1. Un stan es un lugar en el que regalan crutch de lo más in.

      Eliminar
  24. Me voy un ratito, espero llegar a tiempo para el funeral.

    ResponderEliminar
    Respuestas
    1. Te esperaremos!!! No puede empezar sin tí :)

      Eliminar
    2. y nos lo retransmites vía twitter
      con el hastag #thewalkingdeadmarlelas
      Jamónima

      Eliminar
  25. Pues sí, Anatxu dice que los turbantes están arrasando esta temporada!!!!! Donde?????? En tú pueblo????

    http://lookandfashion.hola.com/fashionmix/2012/07/

    ResponderEliminar

WHAT THE FUCK ARE YOU TALKING ABOUT!!!

Marlelas queridas: Gracias por venir a comentar lo que veis por ahí. Os queremos a todas.